Similar sites like cat-breed-info.com and alternatives

Over 50 different cat breeds exist in all shapes and ’) Cat Breed Info ☰ ˟ Home Finicky Feline Store Ask a Professional Your Contributions My Blog Cat Breeds & Pictures Common Cat Breeds Popular Cat Breeds S

Topics: cat breed information,cat breeds infographic,cat breed in the philippines,cat breed in india,cat breed in ancient egypt,cat breed in malaysia,cat breed in crossword

Semrush Rank: 1,566,822 Est. Website Worth: $ 17,050

Sites similar to cat-breed-info.com - Top 15 cat-breed-info.com alternatives

catbreedslist.com

Title: Cat Breeds List - 70+ Cat Breeds with Pictures and
Description: Most Popular Cat Find the best cat breed for you and your family. Learn about its price, personality, lifespan, grooming, shedding, and
Semrush Rank: 41,264 Website Worth: $ 636,900
Topic: cat breeds list,cat breeds list alphabetical,cat breeds list with pictures,cat breeds list with photos

Is it similar? Yes 0 No 0

acabreeds.com

Title: ACA Breeds - ACA Dogs - American Canine Breed
Description: American Canine Association - ACA Breeds - ACA ACA Breed standards for ACA dogs. The American Canine Association’s breeder standards for ACA registered dogs. Learn more about the American Canine Association breed standards and pedigrees. ACA vs AKC breed
Keywords: aca, breeds, dogs, breed, standard, description, aca breeds, aca dogs, breed-descriptions, american, canine, association, breeding, dog show, akc vs aca, aca-vs-akc
Semrush Rank: 4,349,427 Website Worth: $ 6,050
Topic: aca breeds,cat breeds,aka breeds,aka breeds of dogs,aka breeds of dogs list

Is it similar? Yes 0 No 0

catdnatest.org

Title: catDNAtest.org: DNA Testing for
Description: DNA Tests Home Lab Info Available Tests Ordering Collecting Samples Understanding Results Articles Contact DNA Tests Available CatDNAtest.org offers affordable feli
Semrush Rank: 1,233,772 Website Worth: $ 21,450
Topic: cat dna test cost,cat dna testing kit,cat dna test kit,cat dna testing breed,cat dna test breed,cat dna test australia,cat dna test,cat dna test canada

Is it similar? Yes 0 No 0

topcatbreeds.com

Title: Top Cat Breeds - Cat health, pawrenting, and products that you can get for your
Description: How To Warm Up Refrigerated Cat Cat health, pawrenting, and products that you can get for your
Semrush Rank: 7,423,267 Website Worth: $ 3,850
Topic: top cat breeds 2021,top cat breeds in us,top cat breeds,top cat breeds in india,top cat breeds 2020,top cat breeds list

Is it similar? Yes 0 No 0

catbreedselector.com

Title: Cat Breed Selector | All About
Description: Cats are Awesome, But Which One’s for Home Colors Colorpoint Harlequin Maltese Tuxedo Calico Tabby Tortoiseshell Bicolor (Piebald) Tabico Torbie Cat Food Fruits and Vegetables Human Foods Cat
Semrush Rank: 741,474 Website Worth: $ 35,750
Topic: cat breed selector,cat breed selector animal planet,cat breed selector purina,cat breed selector quiz

Is it similar? Yes 0 No 0

catbreedsjunction.com

Title: Cat Breeds
Description: Cat Breeds JunctionA Meeting Place for Cat Stunning cat breeds photos with awesome breed facts to match. Make this your cat resource for health problems, cat care and reviews on cat litter and essential feline nutrition
Semrush Rank: 1,616,021 Website Worth: $ 16,500
Topic: cat breed generator,cat breed selector,cat breeds list,cat bread,cat breeds

Is it similar? Yes 0 No 0

catbreedsfaq.com

Title: Cat Breeds FAQ — Answering Questions About Cat
Description: Cat Breeds: A Guide Into the World of Friendly If you’re looking for information on cat breeds, you’ve hit the jackpot. Welcome to the Cat Breeds FAQ site! Do you have a question in mind? [ FIND OUT MORE
Semrush Rank: 1,343,000 Website Worth: $ 19,800
Topic: cat breeds fluffy,cat breeds from egypt,cat breeds for kids,cat breeds for beginners,cat breeds from japan,cat breeds from asia,cat breeds,cat breeds for sale

Is it similar? Yes 0 No 0

catbreedo.com

Title: Cat Breedo
Description: A Complete Guide of Cat Find the Authentic Cat Knowledge As Per Our Expert Deep Analysis Of Dr. Louise
Semrush Rank: 2,119,033 Website Worth: $ 12,650
Topic: cat breeders,catbreedsjunction,cat breeds list,cat breeder sensei,cat breeds,cat breed selector

Is it similar? Yes 0 No 0

fussiecatca.com

Title: Home | Fussie
Description: Our top of page Join us on the app Artboard 1 Fussie Cat Canada [email protected] (888) 897-7207 Home Products What’s Inside? Contact Subscribe Our Appr
Keywords: Canada
Semrush Rank: 27,525,658 Website Worth: $ 1,100
Topic: fussie cat cans,fussie cat cat food recall,fussie cat canned cat food,fussie cat cat food where to buy,fussie cat cat food,fussie cat canned food,fussie cat canned food review,fussie cat canned

Is it similar? Yes 0 No 0

cat-breeds.com

Title: Cat Breeds with Pictures from A-Z -
Description: There are countless cat breeds. Each of them has an unmistakable character. Find the right cat breed for you in our
Semrush Rank: 3,133,224 Website Worth: $ 8,800
Topic: cat breeds in india,cat breeds list,cat breeds a-z,cat breeds usa,cat breeds uk,cat breeds,cat breeds minecraft,cat breeds with pictures

Is it similar? Yes 0 No 0

rare-breed.co.uk

Title: Rare
Description: We know that great things can be achieved when there is a shared ambition to create long-term Work About Journal Contact Trigger menu Work About Journal Contact We know that great things can be achieved when there is a shared ambition to create lon
Semrush Rank: 29,808,028 Website Worth: $ 1,100
Topic: damn papi you a rare breed,rare-bred,the rare breed,rare dog breeds,rare breeds nz,rare cat breeds,rare breed wild turkey,rare breeds survival trust

Is it similar? Yes 0 No 0

catcatcat.com

Title: CatCatCat | Your Source Cat Related Reviews Including Toys and
Description: Keep up with these crazy CatCatCat is your one stop shop for everything cat related. Here you’ll find reviews, videos, and tips to help you give your cats the best life
Semrush Rank: 33,719,247 Website Worth: $ 1,100
Topic: catcatcatcatcatcatcatcatcatcatcatcat,cat cat cat cat cat cat cat,catcatcatcatcatcatcatcatcatcatcatcatcatcatcat,catcatcat_209,catcatcatcatcatcatcatcatcatcatcatcatcatcat,cat cat cat cat cat cat,catcatcate

Is it similar? Yes 0 No 0

cat-kit.com

Title: Cat-kit
Description: Udtryk følelser på nye CAT Om CAT KIT Funktioner Kurser Om os Kontakt Log ind Bestil Choose language Choose language DA SE NO IS UK/US IT DE Udtryk følelser på nye måder "I am a
Semrush Rank: 3,733,618 Website Worth: $ 7,150
Topic: cat-kit de tony attwood,cat-kit autism,cat kitty cat song,cat kitty cat,cat kitty,cat-kit di tony attwood,cat kitty cat cat kitty cat cat

Is it similar? Yes 0 No 0

russianbreeder.org

Title: Russian Honey Bee Breeders Association, Inc. -
Description: Russian Honeybee Breeders
Keywords: bee, honeybee, queen bee, queen honeybee, russian bee, russian queen, russian honeybee, russian breeder, bee breeders
Semrush Rank: 2,815,099 Website Worth: $ 9,350
Topic: russian breeders,russian breed of cat,russian breed of dog,russian breed horse,russian breed cat,russian breed dogs

Is it similar? Yes 0 No 0

whatbreesees.com

Title: whatbreesees | I see A LOT of live
Description: Tall Heights with Upper I see A LOT of live
Semrush Rank: 9,171,230 Website Worth: $ 3,300
Topic: what breed is doge,what breed is my dog,what breed of dog am i,what breed is scooby doo,what breed is snoopy,what breed is the target dog,what breed is my cat quiz,what breed is my cat

Is it similar? Yes 0 No 0

Please only suggest if the website is similar. We do check suggested websites carefully and only approve if it's completely similar.

Site Url

Why do you think it is similar?

Email address We'll never share your email with anyone else. You'll get a confirmation email.

4 (times) 5

I'm sure it's similar Yes

What is website-like.com?

website-like.com is a free tool to search and find Similar Websites, alternatives or related to the given site.
It helps you to find similar sites based on keyword overlap and shared audience.
"Similar sites like" first finds the best and top keywords for all websites and rank them.

Some random sites

google.com

target.com

Similar sites like cat-breed-info.com and alternatives

Sites similar to cat-breed-info.com - Top 15 cat-breed-info.com alternatives

Latest 5

Top 5

Most 5

Some random sites