Similar sites like catscratching.com and alternatives

Cat Scratching: Explanations and Cat Scratching Solutions by a

Keywords: cat scratching, cats, scratching, scratch, cat behavior, kittens, kitten, cat information, declawing, veterinarian
Topics: catscratchingpostfromprime,cat scratching,cat scratching post from amazon,catscratchingposttoputoncouch,cat scratching posts,cat scratching pads,catscratchingbedatamozan

Semrush Rank: 719,478 Est. Website Worth: $ 36,850

Sites similar to catscratching.com - Top 13 catscratching.com alternatives

happycatvancouver.com

Title: Happy Cat Feline Essentials - a store for cats and their
Description: We are Vancouver’s only all-cat supply store! Dedicated to making all cats happy and healthy - through better nutrition, enrichment and
Semrush Rank: 1,913,383 Website Worth: $ 13,750
Topic: happy cat angry cat,happy cat animated,happy cat and happy dog,happy cat vancouver,happy cat angry cat stretch,happy cat and dog,happy cat anime,happy cat and snob dog

Is it similar? Yes 0 No 0

whitecatcreations.co.za

Title: White Cat Creations - Your premier laser cutter, laser etcher and laser engraver in Heidelberg,
Description: White Cat Creations is situated in Heidelberg, Gauteng. We lasercut, laser engrave and laser etch. We assist with vector drawings would love to hear from
Semrush Rank: 27,244,753 Website Worth: $ 1,100
Topic: white cat creature meme,white cat crafts,white cat screaming,white cat scream meme,white cat creations,white cat scratching post,white cat screaming meme throw pillow

Is it similar? Yes 0 No 0

fussiecatca.com

Title: Home | Fussie
Description: Our top of page Join us on the app Artboard 1 Fussie Cat Canada [email protected] (888) 897-7207 Home Products What’s Inside? Contact Subscribe Our Appr
Keywords: Canada
Semrush Rank: 27,525,658 Website Worth: $ 1,100
Topic: fussie cat cans,fussie cat cat food recall,fussie cat canned cat food,fussie cat cat food where to buy,fussie cat cat food,fussie cat canned food,fussie cat canned food review,fussie cat canned

Is it similar? Yes 0 No 0

scratchking.ca

Title: Dent King Autobody & PDR | Private-pay Autobody and Paintless Dent
Description: honest. Home Autobody PDR (236) 420-KING (5464) honest. transparent. backed by decades of experience. We are a Private-Pay Autobody and Paintless Dent Repair Shop
Semrush Rank: 0 Website Worth: $ 500
Topic: scratching causes hives,scratching causes welts,scratching cats back near tail,scratching cat under chin,scratching card,scratching canvas,scratching cat,scratching causing petechiae

Is it similar? Yes 0 No 0

thescratchingpost.org

Title: Home | The Scratching
Description: CHECK OUT OUR ADOPTABLE CATS ON top of page Home About Us Adopt Contact Sponsor-A-Cat Plant Toxicity Why We Don’t Support Declawing Membership Resources Volunteer The Scratching Post Cin
Semrush Rank: 1,751,675 Website Worth: $ 15,400
Topic: the scratching post cattery,the scratching post cat rescue,the scratching post waltham abbey,the scratching post cincinnati,the scratching post lewisburg pa,the scratching post ohio,the scratching post battle cats

Is it similar? Yes 0 No 0

furry-tail.ca

Title: FurryTail - Hand Them the World on A Furrytail
Description: ⭐️ Free Shipping On $69.99 and up! (U.S) ⭐️ Free Shipping On $69.99 and up! (U.S) Welcome to our store ? Free Shipping For New Customer (Limited Time) | C
Semrush Rank: 0 Website Worth: $ 500
Topic: furrytail cat time cat scratching post tree,furrytail cat litter,furrytail cattery,furry tail come true nazareth,furry tales cat rescue ottawa,furry tail cat,furry tails cat rescue,furrytail canada

Is it similar? Yes 0 No 0

catcatcat.com

Title: CatCatCat | Your Source Cat Related Reviews Including Toys and
Description: Keep up with these crazy CatCatCat is your one stop shop for everything cat related. Here you’ll find reviews, videos, and tips to help you give your cats the best life
Semrush Rank: 33,719,247 Website Worth: $ 1,100
Topic: catcatcatcatcatcatcatcatcatcatcatcat,cat cat cat cat cat cat cat,catcatcatcatcatcatcatcatcatcatcatcatcatcatcat,catcatcat_209,catcatcatcatcatcatcatcatcatcatcatcatcatcat,cat cat cat cat cat cat,catcatcate

Is it similar? Yes 0 No 0

wiskicat.com

Title: WISKI | Modern Cat
Description: Beautiful, modern cat furniture that you’ll love as much as your cat does. Made in the
Semrush Rank: 3,029,654 Website Worth: $ 8,800
Topic: whisky cattos,whiskycat,whiskycat1494,wiski cat scratching cone where to buy,wiski cat scratching cone,whiskas cat food,wiski cat cone

Is it similar? Yes 0 No 0

cat-kit.com

Title: Cat-kit
Description: Udtryk følelser på nye CAT Om CAT KIT Funktioner Kurser Om os Kontakt Log ind Bestil Choose language Choose language DA SE NO IS UK/US IT DE Udtryk følelser på nye måder "I am a
Semrush Rank: 3,733,618 Website Worth: $ 7,150
Topic: cat-kit de tony attwood,cat-kit autism,cat kitty cat song,cat kitty cat,cat kitty,cat-kit di tony attwood,cat kitty cat cat kitty cat cat

Is it similar? Yes 0 No 0

thescratchcinema.com

Title: HugeDomains.com
Description: thescratchcinema.com is for Questions? +1-303-893-0552 Captcha security check thescratchcinema.com is for sale Please prove you’re not a robot View Price Processing Dedicated to cust
Semrush Rank: 0 Website Worth: $ 500
Topic: thescratchchimp,the scratching post lewisburg pa,the scratching post waltham abbey,the scratching post cattery,the scratching post cat rescue,the scratching post ohio,the scratching post cincinnati,the scratching post

Is it similar? Yes 0 No 0

4claws.com

Title: InMotion
Description: ngx234.inmotionhosting.com ngx234.inmotionhosting.com Your IP is
Semrush Rank: 8,369,410 Website Worth: $ 3,300
Topic: 4claws elevated cat feeder,4claws cat scratcher,4claws touch,4claws furry pet bed/mat,4claws refill,4claws wall mounted scratching post,4claws scratching post

Is it similar? Yes 0 No 0

stylish-cats.com

Title: Comb Hair Remover - StylishCats –
Description: One key cleaning Convenient and labor-saving, Integrated design of cleaning button. Unique push board design, Easy and clean. Movable needle surface, Massage, Love and love more, Beauty props. Delicate self-cleaning
Semrush Rank: 0 Website Worth: $ 500
Topic: stylish cat pics,stylish cat toys,stylish cat tower,stylish cat scratcher,stylish cat furniture,stylish cat scratching post,stylish cat litter box,stylish cat tree

Is it similar? Yes 0 No 0

thescratchlist.com

Title: America’s Golf Archives -
Description: A Photo Archive of The Finest Courses In America’s Golf Archives Home Top 100 LIST GOLF DIGEST TOP 200 2020-2021 GOLF MAGAZINE TOP 100 GOLF MAGAZINE TOP 100 (Public) Golf Week Rankings > GOLF
Semrush Rank: 6,018,095 Website Worth: $ 4,400
Topic: the scratch line sam proctor,the scratching post,the scratch line,the scratching post ohio,the scratching post cattery,the scratching post lewisburg pa,the scratching post cat rescue,the scratching post waltham abbey

Is it similar? Yes 0 No 0

Please only suggest if the website is similar. We do check suggested websites carefully and only approve if it's completely similar.

Site Url

Why do you think it is similar?

Email address We'll never share your email with anyone else. You'll get a confirmation email.

4 (times) 5

I'm sure it's similar Yes

What is website-like.com?

website-like.com is a free tool to search and find Similar Websites, alternatives or related to the given site.
It helps you to find similar sites based on keyword overlap and shared audience.
"Similar sites like" first finds the best and top keywords for all websites and rank them.

Some random sites

google.com

target.com

Similar sites like catscratching.com and alternatives

Sites similar to catscratching.com - Top 13 catscratching.com alternatives

Latest 5

Top 5

Most 5

Some random sites